Information

Tools I can use to find similar genes

Tools I can use to find similar genes



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

What tools are available to estimate the function and purpose of a gene ? I think the right approach is to find similar sequences of genes that we know the function of.

All the information I have on a gene is (for example):

KXN84633.1

and

>lcl|Query_208731:23119-24312 CTACAGACATATCCCATCCAGAAGAAATCTTTATCTATCGAATACCTTCGCGATAACGCGTATCTACGCG CTCGAACAGGCCAAATAGCTGCAATGTTAAGGCTGAGGGATAGTATTTCCAAAAACCTATCCCGGCATTT TGAGGTACATTTACTTTCTTCCGTATCTGGCCTGACTAAAAATCCTGCGTAGTCTCAAGGGTTTACATAT ACTCATACGCCTATAATAACAGCTAGCGATTGCGAAGGCGCAGGCGAAGCATTTCGCATATCACCTATCC AACCTACCACCCCCTCTCTCTCAAAAACTGACGCAAGTTCAGACGCAAATACCCCTATAGAGTTCTTTTC ACGTCCTGCATATCTCACAGTCTCGCATCAACTTCATCTAGAATCCTTCACCACGGCTCTCTCTCGCGTG TATACCCTTTCACCATGTTTTCGTGCGGAACGATCTATGACTGGACGACATCTGGCCGAGTTCTGGATGC TTGAGGCCGAGTGGAACCTTGCAACGCGTTGCGATAGCTTAGAAGAAATTTGTGCCTTTGTGGAAGGCTT AATTCGGACGTCGGTAGATCATGAGTCGCAGGATGTCAAGGCTCTGTGGGCGGAGAAAGGAGCGGAAGTA GAGGAATTCAAGATGTTTCGTGCCGCATTTGACAACGCTCAGCCTTGGAGGCGATTAACATACTCGGATG CAGTCGAGGCGTTGAGCACGGCTTATGTCAACGGACATCCTTTCGAATTCAAACCTGTCTGGGGCGAATC ACTCTCGAGCGAACATGAACGTTGGCTGGCAGAGGTGTACGTTGGTGGACCAGTGTTCGTGACAGACTAC CCTATCAAACTTAAACCGTTTTATATGCGGGTCAACGAAGATGGGAAAACCGTTGCGTGTTTCGATTTGA TTGTACCTCATGCTGGTGAACTTGTGGGTGGAAGTGTGAGGGAGGAGAGATGGGATGTCCTCTCAAAACG GATGGCAGAGCATGGATTGTTGCCTCACCCTGACCAGAATGAGGGTGCCCCAACTGATTCGACATATGAA TGGTATCTGGATTTACGCAAGTATGGTGGAGCGCCGCATGCAGGGTTTGGTCTTGGGTTTGAAAGGCTGG TGAGCTGGGTTGGAGGGATTGACAATGTGCGAGAATGCATCGGCATGCCTCGGTGGACTGGGAGAATGAT TATG >lcl|Query_208731:22646-23071 ATGCTCCTTCGCAGGTTATACTCGACTGCTGCACATCCTGCCAGGTTCAAACTACCGCCGACAATCAAAC AGGTGCTTTCAGCTAATGGCAGCGAAAGTTCAGCGACATCAGTGACTGGCTGGATTAAATCTATCCGTAA ACAGAAAAACATAACCTTCGCTGTAGTCAGTGATGGTACAACACCAGAGGGCCTGCAAGCAGTTGTGTCA AAAGAACAGGGTACTTCCCCAGAAATGTTGAAAAGGTCAGTTCATCTCTCACAGCTCGAAACCGGAACAC TCACCAATTGAAGACTTACGAACGGTACAGCAGTGCGGCTCACAGGAAATCTAATTCAGTCTCCTGGCCG AGGTCAAGAATGGGAGCTTGTCATTCAAGAAGGTGACAAGAACGCTATCGAAATCCTCGGCGACTGTGAT ATTGAC >lcl|Query_208731:c22559-22323 ATATCACATTCAACATCCAGGGTAATGACATCGCCATGTCGCTAGACAGCGTCGACAATGACTTCCAAGA AACACTCGTTCCCATCTCCACTGGAATCTCTCTGGAACTCGATCTTATCAAACCCCGTCAACCGCAAGAG CAAGAGTCCAAACTAGCAATCTGTCTTCACCCCTGGTCTCGACTCGGAGGACGCAAAAGCGACCCGTGCG GTGTCTTATTCCACGAGCTCAGGTCGA >lcl|Query_208731:c23949-23902 CACGAACACTGGTCCACCAACGTACACCTCTGCCAGCCAACGTTCATG
obviously I am new to this :)

I personally do not find the second part with the queries helpful without greater context.

The first part appears to be an accession number (more information on these can be found here: https://www.ncbi.nlm.nih.gov/Sequin/acc.html). By going to NCBI (https://www.ncbi.nlm.nih.gov/) and searching that accession number, you can get a lot of information quickly and easily. Searching this particular number shows it to be a Asparagine-tRNA ligase from the fungal genus Leucoagaricus (https://www.ncbi.nlm.nih.gov/protein/KXN84633.1/).

If you simply have a DNA or protein sequence and no accession number, you can perform a BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi). This will search your sequence against a massive database of annotated DNA or protein sequences. The specific type of BLAST to run and the ideal parameters will take some reading on your part to determine. However, if you're just starting out, nucleotide BLAST for DNA sequences, protein BLAST for protein sequences, and default parameters will often suffice. This search will provide you with the best "hits" to the database which you can then follow up on to get an idea of the function of your original sequence.