Information

Confusion regarding seedless grape and the normal process of germination

Confusion regarding seedless grape and the normal process of germination



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

In general, does seedless grape by definition contains seed or is the seed small enough that the process of ingestion creates the illusion that there is no seed?

If the latter is true, is the seedless grape capable of germination?

Lastly does the fruit part of the seeded grape function as an incentive for animals to ingest it and provide nutrients for seeds in the form of feces, or can it function as nutrient itself?

Thanks


The seedless grape technically has a seed, but the seed has no hard outer shell and is microscopic/invisible. These seeds aren't viable. Technically you could isolate out the seed tissue from the grape and grow it in specialized germination medium, but that process also works for any other part of the grape plant. Hooray cuttings! Certainly the seedless grape would not grow if you put it in the ground.

The fruit part of the seeded grape is 'bait' to get animals to ingest the grape and carry the seeds within inside their digestive tracts. The goal is distance, but the surrounding feces provides bonus nutrients. The fruit is not designed to feed the seedling grape, but instead to act as bait for herbivores. The grape is mostly sugars and water, which makes them excellent bait but not amazing plant food. Plants can make sugar from the sun and pull water from the ground, but nitrogen and phosphorus are harder to come by.

Contrast fruit (which are for animals) with coconuts, which are examples of large fruit storing lots of calories for the seedling itself. The coconut flesh isn't as sweet as fruit, and it's much harder to get at.


Conventional breeding in grape is tedious and time-consuming. The long juvenile phase of grape delays first flowering and fruit setting. Use of genomic tools including, genetic engineering, functional genomics, genome wide association and bioinformatics facilitate exploitation of traits to shorten breeding cycles. Short breeding cycles can be achieved by selection and screening of the best cultivars in the genebank. However, it is time consuming to develop new cultivars. The incorporation of traits to the new grape cultivar is done through conventional breeding by crossing male and female parents with contrasting traits. In addition, application of molecular markers can easily identify Quantitative Trait Loci (QTLs) influencing traits of interest for fastening introgression into the recipient grape cultivars by backcrossing method. Genetic engineering is another tool that uses Agrobacterium tumefaciens and biolistic mediated transformation whereby targeted genes are inserted into a DNA of a new grape cultivar for regeneration for example, grape transgenes. In a hybridization study, in which a seedless cultivar is used as maternal genotype, embryo rescue technique is necessary. Some traits in consideration in grape breeding include, flowering time, yield, drought tolerant, diseases resistance, sugar content and wine quality. Therefore, the application of genomic and genetic engineering tools is inevitable for grape improvement.

Key words: Biotechnology, Breeding, Germplasm, Molecular Marker, QTL, Trait.


REVIEW article

  • 1 Laboratorio de Biolog໚ Molecular y Biotecnolog໚ Vegetal, Departamento de Genética Molecular y Microbiolog໚, Pontificia Universidad Católica de Chile, Santiago, Chile
  • 2 Nྫྷleo de Investigación en Producción Alimentar໚, Facultad de Recursos Naturales, Escuela de Agronom໚, Universidad Católica de Temuco, Temuco, Chile
  • 3 Ecophysiology and Functional Genomic of Grapevine, Institut des Sciences de la Vigne et du Vin, Institut National de la Recherche Agronomique, Université de Bordeaux, Bordeaux, France

Grapevine fruit development is a dynamic process that can be divided into three stages: formation (I), lag (II), and ripening (III), in which physiological and biochemical changes occur, leading to cell differentiation and accumulation of different solutes. These stages can be positively or negatively affected by multiple environmental factors. During the last decade, efforts have been made to understand berry development from a global perspective. Special attention has been paid to transcriptional and metabolic networks associated with the control of grape berry development, and how external factors affect the ripening process. In this review, we focus on the integration of global approaches, including proteomics, metabolomics, and especially transcriptomics, to understand grape berry development. Several aspects will be considered, including seed development and the production of seedless fruits veraison, at which anthocyanin accumulation begins in the berry skin of colored varieties and hormonal regulation of berry development and signaling throughout ripening, focusing on the transcriptional regulation of hormone receptors, protein kinases, and genes related to secondary messenger sensing. Finally, berry responses to different environmental factors, including abiotic (temperature, water-related stress and UV-B radiation) and biotic (fungi and viruses) stresses, and how they can significantly modify both, development and composition of vine fruit, will be discussed. Until now, advances have been made due to the application of Omics tools at different molecular levels. However, the potential of these technologies should not be limited to the study of single-level questions instead, data obtained by these platforms should be integrated to unravel the molecular aspects of grapevine development. Therefore, the current challenge is the generation of new tools that integrate large-scale data to assess new questions in this field, and to support agronomical practices.


Genome-wide Identification, Phylogenetic Analysis, and Expression Profiling of CONSTANS-like (COL) Genes in Vitis vinifera

The CONSTANS (CO) gene plays an important role in the flowering of plants. However, the other precise roles of the CO gene are poorly understood. We carried out a genomic census and analysis of expression patterns for CONSTANS-like genes in Vitis vinifera (VviCOLs) to reveal the molecular characteristics of VviCOLs. Twelve VviCOLs were identified and 11 of their full-length complementary DNAs were cloned. Multiple sequence alignment suggested the VviCOLs contained B-box and CCT conserved domains. We further classified the VviCOLs into three groups according to the variability of the second B-box domain. Synteny analysis showed that eight orthologous gene pairs were identified between grapevine and Arabidopsis, suggesting that eight pairs may descend from a common evolutionary ancestor. Tissue expression analysis of COL genes in cv. Pinot Noir showed VviCOL11a and VviCOL11b were specifically expressed in flower bud, whereas VviCOL16b was only expressed in leaves. Ten VviCOLs were expressed in the developing ovule and six of them showed higher expression in the ovule of cv. Thompson Seedless than that of cv. Pinot Noir, indicating that VviCOLs were involved in the process of seed development or ovule abortion. Furthermore, nine of twelve VviCOLs were expressed in cv. Pinot Noir leaves and all of these nine genes had a response to exogenous hormone application. In summary, our findings provide a new insight into the further studies of VviCOLs, especially in terms of seed development and hormone response.

This is a preview of subscription content, access via your institution.


Nanofertilizers for sustainable fruit production: a review

The demand for quality food is expected to increase with the rising population across the globe. Fruits are a major source of nutraceuticals, yet nutrient depletion in soils is altering fruit cultivation. Conventional fertilizers have raised food production after the green revolution, yet intensive agriculture has induced soil degradation and food contamination by pesticides. Conventional fertilizers are poorly efficient, and only about 20% or less of the applied fertilizer is used by the crop plant, the rest being mineralized or leached to groundwater and rivers, causing issues of cost, eutrophication and human health. Alternatively, nanofertilizers appear promising because nanoparticles display unique properties due to their physicochemical characteristics at the nanoscale. Here, we review applications of nanoparticles in fruit crops. Benefits include fruit productivity, quality and shelf life through their positive effects on anatomical, morphological, physiological, physicochemical and molecular traits. We also discuss the role of nanofertilizers in gene expression, regulation and translocation for mitigating abiotic stresses.

This is a preview of subscription content, access via your institution.


Conclusions

This comparative transcriptomic study revealed a more substantial change in the transcriptome profile of RG leaves than in SY leaves during the early stages of infection by B. cinerea (Fig.8 8 ). Some of the putative defense mechanisms include the following: (1) early defense responses related to cell walls might facilitate the resistance of SY leaves to B. cinerea (2) ROS accumulation and cell death processes facilitate the susceptibility of RG leaves to B. cinerea (3) regulation of the ABA pathway and ROS-responsive genes through WRKY and MYB genes might play roles in grapevine resistance (4) different responses in terms of C/N metabolism might contribute to the contrasting resistance levels (5) preinfection attributes of SY leaves contribute to higher B. cinerea resistance because of higher basal expression of genes associated with C/N metabolism, antioxidant metabolism, and immunity to B. cinerea compared with those of RG leaves and (6) high basal expression of VaWRKY10 in grapevine should help in the defense against B. cinerea.

a and b show the putative defense mechanisms of infected RG and SY leaves, respectively. The text in blue indicates genes whose expression was downregulated or the associated bioprocesses with sets of genes whose expression was downregulated. The text in red indicates upregulated expression, inscreased activities of CAT and POX, or increased levles of ABA and ROS. The text in light blue and pink shows slight down- and upregulated expression, respectively, and the text in yellow indicates no significant difference in expression, activities of CAT and POX and levels of ROS. c and d show basal expression differences between the control RG and SY leaves. The text in blue represents relatively low basal expression. The text in red indicates relatively high basal expression, CAT activities and ROS levels. Yellow indicates no significant difference. RG Vitis vinifera cv. Red Globe, SY V. amurensis Shuangyou


Materials and methods

Grape materials, B. cinerea disease assays, and physiological studies

RG, SY, and Thompson Seedless plants were maintained in a vineyard overseen by the grape germplasm and breeding program at Northwest A&F University, Shaanxi, China. Detached grape leaves and berry assays, statistical analysis and microexamination of fungi and lesion development as well as the measurement of CAT and POD activities were all carried out as previously described 7 . The detection of ABA levels was performed using a high-pressure liquid chromatography (HPLC) system at a testing center at China Agricultural University as previously described 48 . Levels of H2O2, MDA, proteins and chlorophyll were measured using previously published methods 49 .

RNA extraction

Samples were collected from three biological replicates over time, and total RNA extraction was carried out using an E.Z.N.A. Plant RNA Kit (Omega Bio-tek, Norcross, GA, USA). The RNA quality and quantity were assessed on a 1.2% denatured agarose gel and a NanoDrop 1000 Spectrophotometer (Thermo Scientific, Wilmington, DE, USA), respectively.

Illumina sequencing and data processing

Strand-specific grape RNA-seq libraries were constructed by Polar Genomics Company and sequenced via the single-end mode on an Illumina HiSeq 2000/2500 platform 50 . A total of 5–10 million reads with a length of 100 bp were generated for each library. Raw read and transcript filtering were performed as previously described 51 , and the final assembled transcripts were aligned to the 12× PN40024 genome and B. cinerea B05.10 genome assemblies 52,53 using BLAT 54 , with a sequence identity ≥97%. Following alignment, the counts of mapped reads from each sample were derived and normalized to reads per kilobase of exon model per million mapped reads (RPKM). Genes that were differentially expressed between B. cinerea-inoculated samples and control samples were identified using the DESeq 1.8.3 package 55 . Genes with an adjusted P value ≤ 0.05 and at least a twofold change in expression were regarded as DEGs.

Data analysis

The ‘Calculate and draw custom Venn diagrams’ system (http://bioinformatics.psb.ugent.be/webtools/Venn/) was used to construct Venn diagrams. Correlations and PCA between samples were performed using an online tool (http://www.omicshare.com/tools). Gene Ontology (GO) categories associated with the sets of DEGs were determined using the Plant MetGenMAP system 56 . Gene clustering was performed by K-means clustering using Genesis software 57 . TFs were confirmed online using Hmmscan alignment (http://www.plantTFdb/animalTFdb). TF-binding sites (TFBSs) in promoter sequences corresponding to the region 2 kb upstream of the transcription start site of genes were analyzed using the JASPAR database 58,59 . A hypergeometric test was used to generate P values adjusted using the Benjamini–Hochberg correction 24 . WGCNA was performed as previously described 27 .

QRT-PCR and semiquantitative reverse-transcription PCR

Primers were designed using Primer 5 software 60 RNA extraction, DNase treatment and reverse transcription were carried out as previously described 61 . qRT-PCR analyses were carried out using SYBR Premix Ex Taq II (TaKaRa Biotechnology) on a Bio-Rad iQ5 thermocycler (Bio-Rad, Hercules, CA, USA). VvActin1 (ID: XM_002282480.4 primer sequence, F: GATTCTGGTGATGGTGTGAGT, R: GACAATTTCCCGTTCAGCAGT) and AtActin1 (ID: AT2G37620 primer sequence, F: GGCGATGAAGCTCAATCCAAACG, R: GGTCACGACCAGCAAGATCAAGACG) were used as reference genes. Relative log2 induction ratios of treated samples compared with those under the control treatment were calculated based on the DD △ t method 48 . Three biological replicates and three technical replicates were analyzed for each experiment. Semiquantitative reverse-transcription PCR was performed as previously described 28 , with each reaction repeated three times and the three independent analyses showing the same trends for each gene and sample.

Transformation of A. thaliana and V. vinifera with VaWRKY10

VaWRKY10 and VvWRKY10 coding sequences were amplified as previously described 61 using PrimeSTAR HS DNA Polymerase (TaKaRa Biotechnology) with gene-specific primers (F: 5′-CGGGATCCATGGAATTCGAATTTATTGATAC-3′, BamH I site underlined R: 5′-TCCCCCGGGTCACCATTTTTCTATCTGAG-3′, Sma I site underlined). The sequences were analyzed using the BLAST program (http://Ncbi.nlm.Nih.gov/blast) of the NCBI database 61 . The VaWRKY10 coding sequence was then fused to the CaMV 35S promoter in a pCAMBIA2300 vector 61 . The pCAMBIA2300-35S-VaWRKY10 vector was then introduced into A. thaliana using the floral-dip method, and 75 mg/L kanamycin was used for identification of transgenic seedlings 62 . The A. thaliana plants were grown under 50–60% relative humidity at 21–23 °C and a long-day photoperiod (16 h light/8 h dark). The pCAMBIA2300-35S-VaWRKY10 overexpression vector was then introduced into A. tumefaciens strain GV3101. A. tumefaciens cultures containing the plasmid were used to transform somatic embryos of the grape genotype Thompson Seedless (Fig. 6c) plantlet propagation was performed at 25 ± 1 °C and a 16 h photoperiod 38 .

A. thaliana and Thompson Seedless B. cinerea resistance assays

Detached leaf assays 7 were used to identify the resistance levels to B. cinerea of same-sized leaves of 4-week-old transgenic A. thaliana seedlings, two-month-old transgenic Thompson Seedless seedlings and their corresponding WT lines. Three biological replicates were analyzed. Droplets containing 1.5 × 10 6 /mL B. cinerea spores were applied to 15-18 A. thaliana leaves per replicate, and the infection was evaluated four days after inoculation by measuring the diameter of the area of spreading lesions 61 . B. cinerea spore suspensions containing 1.5 × 10 6 spores /mL were sprayed onto 15–18 Thompson Seedless grape leaves per replicate. The infection was then evaluated by calculating the percentage of spreading lesions on each leaf 7 .


Abstract

Serotonin is an ancient indoleamine that was presumably part of the life cycle of the first prokaryotic life forms on Earth millions of years ago where it functioned as a powerful antioxidant to combat the increasingly oxygen rich atmosphere. First identified as a neurotransmitter signaling molecule in mammals, it is ubiquitous across all forms of life. Serotonin was discovered in plants many years after its discovery in mammals however, it has now been confirmed in almost all plant families, where it plays important roles in plant growth and development, including functions in energy acquisition, seasonal cycles, modulation of reproductive development, control of root and shoot organogenesis, maintenance of plant tissues, delay of senescence, and responses to biotic and abiotic stresses. Despite its widespread presence and activity, there are many questions which remain unanswered about the role of serotonin in plants including the mode of signaling and receptor identity as well as the mechanisms of action of this important molecule. This review provides an overview of the role of serotonin in plant life and their ability to adapt.


Morphological and physiological responses of tara (Caesalpinia spinosa (Mol.) O. Kuntz) microshoots to ventilation and sucrose treatments

One of the main problems of in vitro plant tissue culture is the poor ventilation in the culture vessels. This leads to morphological and physiological anomalies in regenerated in vitro plants, a crucial issue in woody species, such as Caesalpinia spinosa (Mol.) O. Kuntz, which is a legominous tree or thorny shrub of the Andes, adequate photoautotrophic and photomixotrophic in vitro rooting systems could eliminate these problems. Therefore, the purpose of the present study was to evaluate photoautotrophic and photomixotrophic treatments to optimize the in vitro rooting of C. spinosa microshoots. Micropropagated shoots were cultured in vessels sealed with a polypropylene lid with 0, 1, or 3 ventilation holes covered with a 0.45-μm adhesive polypropylene microfilter. The vessels contained MS salts with or without 30 g L −1 sucrose or, alternatively, a porous substrate (PRO-MIX®), which facilitated rooting and produced greater fresh and dry weights, a higher concentration of photosynthetic pigments and phenolic compounds, and more developed leaves. The optimal performance and higher survival was obtained by using PRO-MIX® with three filters for increased ventilation. For treatments in agar, only the one with sucrose and highly ventilated (three filters) reached a performance approaching that with PRO-MIX®. To date, the presented results have not been reported in scientific literature for C. spinosa.

This is a preview of subscription content, access via your institution.


13 - Irradiation of fresh fruit and vegetables

Food irradiation is a cold process for preserving food and has been established as a safe and effective method of food processing and preservation after more than five decades of research and development. Although for some time a consensus has been reached in the scientific community about the wholesomeness of gamma irradiation of food, the general public remains concerned about this technology even though a number of recent reports show increasing interest in food irradiation from government regulators and industry and decreasing apprehensiveness of the public. Food irradiation is not a new technology. Today, it is approved by more than 40 countries for more than 100 irradiation food items or groups of food for consumption. This chapter discusses the action of ionizing radiation, sources of ionizing radiation, and the concepts of dose and different dose levels used in the radiation processing. It also includes disinfestations, shelf-life extension, decontamination, and advantages and disadvantages of food irradiation, with special focus on fruit and vegetable applications in the scope of irradiation. The chapter further reviews the current status of analytical methods used in the detection of irradiated fruits and vegetables under analytical detection methods and presents a summary of the applications relative to fruits and vegetable preservation.


Watch the video: Fruits and seed Formation of a Pollinated plant. Full explanation For kids (August 2022).